Regulation of salivary protein expression by tannins and beta-adrenergic antagonists and cloning of a cDNA encoding the rat parotid proline -rich glycoprotein PGP 200
Abstract
Isoproterenol administration induces families of proline-rich proteins in rat parotid and submandibular glands. The induction of these proteins occurs via the $\beta$-adrenergic receptor and is transcriptionally regulated. Tannins mimic the induction of proline-rich proteins in the parotid glands via activation of the $\beta\sb1$-adrenergic receptor and transcription is regulated either by tannins or a $\beta\sb1$-agonist. The $\beta\sb1$-adrenergic antagonist, atenolol, induces a series of acid-soluble proteins in submandibular glands. These proteins are high in glutamine/glutamic acid and proline and have a high affinity for tannins. This high affinity may play a role in the detoxification of various related dietary components. Two proline-rich glycoproteins (PGP 200 and SGP 158) from rat parotid and submandibular glands, respectively, have similar peptide sequences, but have different glycosylation patterns. Studies presented by this thesis show that the expression of these two proteins are regulated differently by tannins and isoproterenol. PGP 200 is induced by both tannins and isoproterenol whereas SGP 158 is only induced by isoproterenol. Antiserum against deglycosylated SGP 158 precipitates a protein of 64,000 molecular weight from cell-free translation products of mRNA from both glands. A cDNA encoding PGP 200 has been cloned from parotid glands of isoproterenol-treated rats and partially sequenced. The nucleotide sequence CCGCGGCCGCCUGAUCAUGGAAACCAGACACAGCCU and deduced amino acid sequence PRPPDHGNQTGP are repeated through the cDNA. This amino acid sequence is identical to that of a glycopeptide isolated from digestions of both SGP 158 and PGP 200.
Degree
Ph.D.
Advisors
Carlson, Purdue University.
Subject Area
Biochemistry
Off-Campus Purdue Users:
To access this dissertation, please log in to our
proxy server.